Wikipedia - User contributions [en]

Tinsley R. Harrison

2014-09-09T14:30:05Z

Kennabt:

{| class="infobox bordered" style="width: 22em; text-align: left; font-size: 75%;"
|-
| colspan="2" style="text-align:center;" | <br>Tinsley Randolph Harrison<br>
|-
| colspan="2" style="text-align:center;" |
|-
| colspan="2" style="text-align:center;" | [[Image:Tinsley_Harrison_Statue1_UAB.PNG|250px| ]]
|-
| colspan="2" style="text-align:center;" | [[Image:Tinsley_Harrison_Statue2_UAB.PNG|250px| ]]
<br>Tinsley Harrison Research Tower, [[University of Alabama at Birmingham]] School of Medicine<br>
|-
|}

'''Tinsley Randolph Harrison''' (March 18, 1900 – August 4, 1978) was a [[USA|US]] [[physician]] and editor of the first five editions of ''[[Harrison's Principles of Internal Medicine]]''.

==Biography==
Harrison was born in [[Talladega]], [[Alabama]], on March 18, 1900. He was the son of Groce Harrison, himself a sixth-generation physician. Having graduated from high school at the age of 15, Harrison attended the [[University of Michigan]], where he also completed one year of medical school before transferring to [[Johns Hopkins University|Johns Hopkins]] [[Johns Hopkins School of Medicine|School of Medicine]] in the fall of 1919. His roommate and tennis partner at Johns Hopkins was [[Alfred Blalock]], with whom he developed a close lifelong friendship. He completed his internship at [[Peter Bent Brigham Hospital]] in [[Boston]], returned to Hopkins for further training in [[internal medicine]], and completed his residency at [[Vanderbilt University]] where he served as the first Chief Resident in the Department of Medicine.

Harrison's special field of interest was [[cardiovascular medicine]] as well as the [[pathophysiology|pathophysiological]] mechanisms of disease. His name is best known among medical practitioners as the founding editor and editor-in-chief of the first five editions of ''[[Harrison's Principles of Internal Medicine]]''. The text initiated several unique approaches to medical textbook writing, and remains, in its current edition, one of the most widely read and regarded textbooks in medicine.

Harrison's career included extensive work in research, publishing, medical education, and medical practice. He taught at [[Vanderbilt University]]'s school of medicine, at what was then the Bowman Gray School of Medicine at [[Wake Forest University]] in North Carolina and at what is today the [[University of Texas Southwestern Medical School]] in [[Dallas, Texas]].

Harrison spent the greatest part of his teaching career at the [[University of Alabama School of Medicine]] (UASOM) in [[Birmingham, Alabama]], where he served as Dean and chairman of the Department of Medicine. At UASOM, Harrison helped initiate a rapid period of growth that included recruitment of nationally known physicians from the faculties of such institutions as [[Harvard University]] and the [[Mayo Clinic]]. This period saw UASOM rise from local to international prominence. The Tinsley Harrison Research Tower at UASOM is named in his honor.

Harrison died in Birmingham at the age of 78.

==References==

*Merrill WH, "What's Past is Prologue" Ann Thorac Surg 1999;68:2366-75
*[http://www.uab.edu/historical/uabchron.html Chronology, UASOM] at uab.edu
*[http://www.findarticles.com/p/articles/mi_qa4113/is_200401/ai_n9350998 "The Doctors Harrison: A Magnificent Obsession"] at findarticles.com

==External links==
* [http://www.amazon.com/gp/product/0071402357 Harrison's Principles of Internal Medicine, 16th Ed.] at Amazon.com.
* [http://main.uab.edu/uasom/show.asp?durki=2023 University of Alabama at Birmingham School of Medicine]

{{University of Alabama at Birmingham}}

{{Authority control|VIAF=85166499}}
{{Persondata 
| NAME =Harrison, Tinsley Randolph
| ALTERNATIVE NAMES =
| SHORT DESCRIPTION = American physician
| DATE OF BIRTH = March 18, 1900
| PLACE OF BIRTH =
| DATE OF DEATH = August 4, 1978
| PLACE OF DEATH =
}}
{{DEFAULTSORT:Harrison, Tinsley Randolph}}
[[Category:American physicians]]
[[Category:University of Michigan alumni]]
[[Category:Johns Hopkins University alumni]]
[[Category:Vanderbilt University alumni]]
[[Category:Vanderbilt University faculty]]
[[Category:Wake Forest University faculty]]
[[Category:1900 births]]
[[Category:1978 deaths]]
[[Category:University of Michigan Medical School alumni]]

Myc-tag

2012-02-15T20:04:56Z

Kennabt: Added common nucleotide sequence for myc tag

A myc tag is a polypeptide [[protein tag]] derived from the [[c-myc]] gene product that can be added to a protein using [[recombinant DNA]] technology. It can be used for [[affinity chromatography]], then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an [[antibody]]. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by [[Western blotting]].

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the [[C-terminus]] and the [[N-terminus]] of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the [[secretory pathway]]. The following nucleotide sequence codes for the myc tag "GAACAAAAACTTATTTCTGAAGAAGATCTG".

A monoclonal antibody against the myc [[epitope]], named 9E10, is available from the non-commercial [[Developmental Studies Hybridoma Bank]]<ref>[http://dshb.biology.uiowa.edu/c-myc Developmental Studies Hybridoma Bank 9E10]</ref>.

== See also ==

[[Polyhistidine-tag]], a different tag used in similar ways

==References==

<references/>
[[Category:Biochemistry]]

Wikipedia:Tutorial (historical)/Editing/sandbox

2012-02-11T06:48:53Z

Kennabt:

{{Please leave this line alone (sandbox heading)}}
Blah blah

Neuroendocrine hyperplasia

2005-08-17T21:00:00Z

Kennabt: Initial Entry on Neuroendocrine hyperplasia

Neuroendocrine Hyperplasia is a progressive hyperplastic process that ultimately results in obliterative fibrosis of predominatly the pulmonary tree. There is no currently recognized treatment for the relentless progression of this disorder.